Ir para o conteúdo principal

Escrever um comentário

Avalilação PREreview de Standardization of Trypanosoma cruzi DNA extraction and purification protocol from samples collected on Whatman 903 filter paper to Chagas disease diagnosis

Publicado
DOI
10.5281/zenodo.8273632
Licença
CC BY 4.0

Reviewers: Marilene Souza Braga and Vitória Jordana B. Alencar

Supervisor: Alicia Juliana Kowaltowski

This review resulted from the graduate-level course "How to Read and Evaluate Scientific Papers and Preprints" from the University of São Paulo, which aimed to provide students with the opportunity to review scientific articles, develop critical and constructive discussions on the endless frontiers of knowledge, and understand the peer review process.

Chagas’ disease is a neglected disorder affecting around 6-7 million people worldwide, and its causative agent is Trypanosoma cruzi. The infection occurs mainly through direct contact with the insect vector's feces, blood transfusion, and vertical transmission. Regarding vertical transmission, in Argentina around 1,500 children are born with congenital Chagas’ disease every year. Treatment of the disease, as recommended by the WHO, is most effective when it is diagnosed in the acute phase, when there is a high level of T. cruzi parasitemia. The current method to diagnose the disease is based on visualizing the movement of T. cruzi, which depends on the visual acuity of the person doing the analysis. Therefore, given that a quick and effective diagnosis is necessary to preserve the health of newborns, having a cheap, effective method that does not require specific storage and transportation conditions is extremely relevant when dealing with neglected diseases. The results reported are important for health policy makers to provide/implement an improvement in diagnosis. Some specific comments are provided below.

Introduction:

- "Chagas disease (CD) is caused by the parasite Trypanosoma cruzi (T. cruzi) affecting more than 6 million people only in Latin America (WHO 2018). Recently, CD has been recognized as a global health concern due to the population mobility that creates opportunities for the spread and the establishment of the disease (Schmunis et al 2010)." The structure of the introduction could be improved. To make it more aesthetic and easier to read, we suggest discussing only the peculiar biology of T. cruzi (in more detail) in the first paragraph, without going into the epidemiological part, and emphasizing the form of transmission at this point. To emphasize the "recently", we suggest citing a current work, or rephrasing this statement.

- "The overall transmission rate is about 1-12% with an average of 5% (Bustos et al. 2019)." Worldwide or in a specific country? Please highlight this in the text.

- "Commonly used methods to diagnose CD in newborns are complicated, the technique recommended by the WHO (Carlier et al., 2019) is direct observation under the microscope (Microhematocrit test) but has limited sensitivity." Before discussing this point, we suggest introducing the problem better, about how the disease presents itself during pregnancy and how it can affect the newborn. Start with the epidemiological distribution worldwide, and then move on to the statistical data on the object of study.

Methods:

- "Upon reaching confluence, VERO cells were incubated with a culture of trypomastigotes forms of T. cruzi VD strain (Tc VI)". Given that there are biological and genetic differences between the various DTUs that include T. cruzi, wouldn't it be interesting to carry out tests on other strains prevalent in South America?

- "specific primers: cruzi1 (ASTCGGCTGATCGTTTTCGA), cruzi2 (AATTCCTCCAAGCAGCGGATA), 0.25 mM SatDNA specific probe cruzi3 (probe) (CACACACTGGACACCAA) (Duffy et al. 2013) TaqMan™ MGB and water to adjust the final volume". Which genes are these primers designed for? Are they genes that are similar to human genes? The primers presented are different from those in the referenced paper.

- "The cards were stored at room temperature and were processed between three and seven days after preparation". Have longer storage times been tested to determine the validity of the samples on the filter paper? Would a time longer than 7 days affect the specificity of the technique in detecting material present on the paper?

- By testing the validity of the samples on paper, it would be possible to uncover the stability of the sample more clearly, as stated in the following conclusion: "several advantages: the properties of the samples are conserved, dried blood on the filter paper is not infectious and biologically stable, allowing the long-term storage of the samples without losing or deteriorating DNA..."

- "However FTA filter paper was used, which is more expensive and not widely used, in the opposite of Whatman 903 paper which is standardized in national public health programs for the detection of metabolic diseases." To affirm that Whatman 903 paper does not affect the sensitivity and specificity of the method, it would be interesting to use FTA paper (gold standard) for comparison in some tests to demonstrate whether there were different or similar results between the two materials, or to look for a reference that provides comparison. We suggest the authors conduct a comparative statistical analysis between the methods to provide evidence of their diagnostic efficiency, so that it can serve as reliable support and be recommended for possible incorporation as a more efficient diagnostic method.

Results

Figure 2: insert a picture with better resolution.

Minor comments

- The primer cruzi1 (ASTCGGCTGATCGTTTTCGA) has an S, which does not characterize a nucleotide.

- Update reference WHO 2018.

- There are no keywords, please add.

- The following link does not work:

http://www.msal.gob.ar/images/stories/bes/graficos/0000000068cnt-p01-manual-de-procedimiento.pdf

Competing interests

The author declares that they have no competing interests.

Você pode escrever um comentário nesta Avaliação PREreview de Standardization of Trypanosoma cruzi DNA extraction and purification protocol from samples collected on Whatman 903 filter paper to Chagas disease diagnosis.

Antes de começar

We will ask you to log in with your ORCID iD. If you don’t have an iD, you can create one.

What is an ORCID iD?

An ORCID iD is a unique identifier that distinguishes you from everyone with the same or similar name.

Começar agora