Commentaires
Écrire un commentaire-
Commentaire de Laura B. Duvall
- Publié
- Licence
- CC BY 4.0
We thank the reviewers for their detailed read and constructive comments on our manuscript – our responses are below.
REVIEW REPORT
—
Mosquitoes lose their drive to host-seek after a blood meal, yet the molecular and neuronal mechanisms underlying this change remain poorly understood. In a previous study, Duval et al. (2019) identified the Neuropeptide Y Receptor (NPY) as a potential mediator of this effect. In the manuscript by Greppi et al, the authors show that NPY-like receptor 7 NPYLR7 acts in specialized rectal cells that sense nutritional cues and relay signals to the nervous system to control reproduction in Aedes aegypti mosquitoes. This work is particularly interesting because it uncovers a completely unexpected neuroendocrine role for the hindgut—a tissue traditionally viewed as a purely osmoregulatory organ—and demonstrates that it is a key site where nutrient sensing is coupled to reproductive investment. This preprint stands out in the field because gut–brain signaling in insects has largely centered on the midgut and central nervous system; the authors reveal a new signaling hub that broadens our understanding of how blood-feeding mosquitoes coordinate physiology and behavior. Their integration of genetics, physiology, imaging, transcriptomics, and ultrastructure provides a strong multi-level support, making the central conclusion—that NPYLR7-expressing rectal pad cells function as a nutrient-sensing node influencing fecundity—highly convincing and influential for future work.
Major comment
1. Clarification of Genotype-Related Behavioral Differences:
The manuscript would benefit from additional clarification regarding a few observations that could strengthen the interpretation of the phenotypes. In several assays, the heterozygous controls show behavioral outcomes that differ from the wild type (e.g., Figure 3b, day 3; Figure 3d, 60 min and 360 min). It would be helpful if the authors could briefly comment on these differences and whether they might reflect dosage effects, compensatory mechanisms, or assay-specific sensitivity.
We appreciate the reviewer’s observation. While we did note modest differences in clearance rates among the genotypes, we believe these variations are unlikely to represent biologically meaningful effects. Instead, they are more consistent with assay-specific sensitivity rather than true dosage-dependent or compensatory mechanisms.
Similarly, the wide range of egg viability observed in the npylr7QF2/QF2 mutants (0–75%, Figure 2c) is intriguing and may provide additional insight into the role of NPYLR7 in reproductive physiology. A brief discussion of potential sources of this variability—for example, differences in the degree of functional disruption among individuals or in physiological states—would greatly aid readers.
We appreciate this comment. We speculate that a major source of the observed variability in egg viability is the reduced, and more variable, protein content in the developing oocytes of the npylr7QF2/QF2 mutants. Small differences in nutrient deposition during oogenesis could have disproportionate effects on embryonic development and successful hatch rates. Additionally, although our analyses focused on total protein content, other components of the eggs may also be compromised including nutrients or molecular factors could further contribute to the variability in viability.
To further support interpretation, the authors may also consider adding a brief clarification in the Methods section regarding how npylr7QF2/+ heterozygotes were distinguished from npylr7QF2/QF2 homozygotes. This additional detail would help readers fully understand the genotype assignments and clarify any potential confusion.
This is a good suggestion, although the presence of 3xp3 dsRed confirms the presence of the transgene, it does not confirm homozygosity. Therefore, to confirm heterozygotes from homozygotes we performed PCR reactions using primers that flank the insertion site and which produce a wild-type band in heterozygous animals and only an insertion band in homozygous individuals:
“A primer pair (F: TTCACTGCCGAGTTCTTCCC; R: TACTGGCATCACTCTTCCGC) flanking the insertion was used, and the presence of the long, insertion-containing product and the absence of the short wild-type product was used to identify homozygous individuals. Homozygous individuals were pooled to establish homozygous lines. These lines were confirmed by the presence of the ds-Red polyubiquitin marker in all offspring when crossed to wild-type Liverpool animals.”
2. Clarification of the Mechanistic Link Between NPYLR7 Signaling and Protein Provisioning:
The authors could further explain the concept of “protein provisioning” and how they propose that NPYLR7 contributes to this process. As written, it appears that the authors envision a multifaceted and potentially indirect mechanism in which NPYLR7 activation—perhaps following a blood meal—elicits neuromodulatory signaling from the rectal pads. However, the connection between this signaling and the outcome of protein provisioning remains somewhat unclear. The authors could expand their discussion of the underlying model, detailing how they believe NPYLR7 influences protein provisioning, either directly or indirectly. Strengthening this section would help readers better understand the proposed physiological pathway and its implications.
Although additional work will be required to fully resolve how loss of NPYLR7 affects oocyte provisioning, our data offer several clues that help refine a working model. Notably, our finding that npylr7-expressing cells respond to amino acids raises the intriguing possibility that the rectum may serve as an underappreciated site of nutrient uptake or nutrient-state sensing:
“While most nutrient transport occurs in the midgut, our transcriptomic data and recent studies reporting amino acid transporter expression in the hindgut50 suggest that this tissue may participate in nutrient uptake or sensing. One hypothesis is that RYamide activation of NPYLR7 following a blood meal triggers protein uptake from the hindgut, serving as a secondary or "last chance" mechanism to ensure that sufficient resources reach the developing oocytes.”
Alternatively, or in parallel, NPYLR7-dependent signaling from the rectal pads may feedback to the midgut to promote or modulate nutrient uptake more broadly.
Minor comments
1. Males possess only four rectal pads; it would be informative for the authors to briefly discuss whether NPYLR7 might have sex-specific roles and whether the mutants exhibit noticeable changes in male fertility or mating behavior. Even a brief note indicating whether these aspects were examined—or why they may fall outside the current scope—would provide helpful context for readers.
This is a great point as mating deficits in the mutant males could also impact their partner’s reproduction. Although a detailed characterization of the mutant phenotypes of males is outside the scope of this study, we have performed mating experiments with these mutants and find no deficits in mating or successful insemination.
2. The EM data are visually striking and add substantial depth to the manuscript. The appearance of multilamellar bodies in the mutants is particularly intriguing and suggests important underlying biology. To further strengthen the interpretation, the authors might consider including some quantitative measures—such as vesicle number, area, or subcellular localization—which would not only support the current conclusions but also provide a valuable reference for future comparative studies. In addition, clarifying whether these multilamellar structures are more consistent with cellular stress, defects in vesicle formation, or with autophagic processes would help readers better understand the possible mechanistic implications. Even a brief discussion of alternative causes other than stress would enhance the impact of this compelling dataset.
We appreciate the reviewer’s comments and thoughtful suggestions. Because the EM dataset was generated from samples prepared across multiple sessions and under conditions optimized for ultrastructural visualization rather than standardized quantification, the current methods do not permit reliable comparative measurements of vesicle number, size, or distribution. However, we agree that such quantitative analyses would substantially strengthen mechanistic interpretation, and these measurements are a key focus of our ongoing work aimed at understanding how NPYLR7 signaling shapes cellular physiology in this tissue.
3. Since diluting the nutrient content of the blood meal did not fully recapitulate the npylr7 phenotype, it may be helpful to explore whether an artificial meal such as SkitoSnack—designed to closely mimic blood composition—produces similar outcomes. Incorporating or briefly discussing this possibility could further strengthen the authors’ interpretation and provide a useful direction for future studies aimed at dissecting the nutritional components underlying the phenotype.
We agree that simple dilution of the blood meal does not recapitulate the npylr7 phenotype. Exploring alternative dietary manipulations, is an excellent suggestion. We are planning future experiments that systematically manipulate meal composition and protein sources, and these approaches will help further dissect the nutritional components that contribute to the npylr7 mutant phenotype.
4. The transcriptomic analysis provides valuable insight into hindgut gene expression. Because the dataset includes both ileum and rectum, the authors might briefly acknowledge that pooling these tissues could potentially dilute rectal pad–specific signatures. A short discussion of this limitation would help readers interpret the data more accurately and appreciate the complexity of identifying region-specific transcriptional changes.
This is a great point, we agree that pooling ileum and rectum in the bulk transcriptomic analysis dilute rectal pad-specific signatures. For this reason, we complemented the bulk sequencing with immunohistochemistry and fluorescent in situ hybridization, which allowed us to spatially localize key transcripts and proteins specifically to the basal ring of the rectal pads.
“To test whether these cells possess the machinery for neurotransmitter synthesis and release, we examined co-expression of secretory components and glutamate synthesis enzymes detected in our bulk sequencing using immunofluorescence and fluorescent in situ hybridization (FISH).”
Competing interests
I am one of the authors of this preprint and am posting a public response to the previous review comments